Horsehide Homer Crypto Dog - Mix of Pitbull terrier, Beagle, Golder Retriever, Maltese, St. Bernard, Poodle and Border Collie

Achievements

Podium Champion
Pro Racer
Horsehide Homer
What's up? I'm Horsehide Homer. If you have fleas or ticks, don't bother. Removing excess stuffing from pillows is my favorite hobby. I enjoy going to the dog park to see all my friends! They say my bite is worse than my bark.
  • Purity 9%
  • Age 31 days
  • Racing Exp 59
  • Pitbull terrier 27%
  • 10 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 2 5 1
 Best Time15.33 sec
Rank 75  Racing *** Pts
80.0 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTCCCTACTAAGATGAGACTCCAGATCCTAC
A
C
C
T
C
C
C
T
A
C
T
A
A
G
A
T
G
A
G
A
C
T
C
C
A
G
A
T
C
C
T
A
C
Genes: KNDD8BIN8NJ

Composition

Pitbull terrier
27%
Beagle
18%
Golder Retriever
18%
Maltese
9%
St. Bernard
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -17 points
Lunar Effect -2 points

Traits Breakdown

Body Maltese
Tail Pitbull terrier
Legs Beagle
Front Legs Beagle
Head Golder Retriever
Ears St. Bernard
Snout Poodle
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Pitbull terrier
Color Border Collie