Addie Abbot Bitcoin Dog - Mix of Corgi, Golder Retriever, Husky, Grey Wolf, Labrador BK, Pitbull terrier, Pug and Dachshund

Achievements

Racer
Addie Abbot
I run with a pack in the data warehouse. I never met a crotch or a butt I didn't like, but I'm just friendly that way. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! As a perfectionist, I have to find just the right 'spot'.
  • Purity 4%
  • Age 30 days
  • Racing Exp 33
  • Corgi 18%
  • 10 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 0 3 1
 Best Time15.55 sec
No rank  Racing *** Pts
40.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCCCCAGAACAGCAACAAGATCCAGCGAAGGA
A
G
C
C
C
C
A
G
A
A
C
A
G
C
A
A
C
A
A
G
A
T
C
C
A
G
C
G
A
A
G
G
A
Genes: OL84648NO2A

Composition

Corgi
18%
Golder Retriever
18%
Husky
18%
Grey Wolf
9%
Labrador BK
9%
Pitbull terrier
9%
Pug
9%
Dachshund
9%

Current Energy

Vitality +28 points
Lunar Effect -14 points

Traits Breakdown

Body Corgi
Tail Grey Wolf
Legs Golder Retriever
Front Legs Husky
Head Labrador BK
Ears Husky
Snout Golder Retriever
Mouth Pitbull terrier
Nose Corgi
Eyes Pug
Color Dachshund