Lili Luna Digital Cryptocurrency Dog - Mix of Poodle, Maltese, Dachshund, Boxer, Border Collie, Grey Wolf, Corgi, St. Bernard and Labrador

Achievements

Pro Racer
Lili Luna
Hey dawg! I'm Lili Luna. My favorite thing is to sit in my humans' laps while they are trying to read or drive. Dragging my butt on the carpet feels so good. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 3%
  • Age 15 months
  • Racing Exp 45
  • Poodle 18%
  • 10 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 0 5 1
 Best Time15.85 sec
No rank  Racing *** Coins
60.0 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAAACGACACCTACCCCAGCTGAACCGACCCA
G
G
A
A
A
C
G
A
C
A
C
C
T
A
C
C
C
C
A
G
C
T
G
A
A
C
C
G
A
C
C
C
A
Genes: AGIKJLOBKI5

Composition

Poodle
18%
Maltese
18%
Dachshund
9%
Boxer
9%
Border Collie
9%
Grey Wolf
9%
Corgi
9%
St. Bernard
9%
Labrador
9%

Current Energy

Vitality -51 points
Lunar Effect -10 points

Traits Breakdown

Body Dachshund
Tail Boxer
Legs Poodle
Front Legs Maltese
Head Border Collie
Ears Grey Wolf
Snout Corgi
Mouth St. Bernard
Nose Maltese
Eyes Poodle
Color Labrador