Paisley Phoebe Litecoin Dog - Mix of Rottweiler, Corgi, Boxer, Beagle, St. Bernard, Yorkshire Terrier, French Bulldog, Border Collie, Grey Wolf and Shiba Inu

Achievements

Racer
Podium Champion
Paisley Phoebe
I love fetching anything my human throws! I pee when I'm excited. I hate it when other dogs pee in my yard! IT'S MY YARD!! I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 1%
  • Age 29 days
  • Racing Exp 44
  • Rottweiler 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 3 1 2
 Best Time15.70 sec
Rank 75  Racing *** Pts
85.7 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCAACCACCTATGATTACGACACTACCCCGTA
A
G
C
A
A
C
C
A
C
C
T
A
T
G
A
T
T
A
C
G
A
C
A
C
T
A
C
C
C
C
G
T
A
Genes: OGHDBF9HJLE

Composition

Rottweiler
18%
Corgi
9%
Boxer
9%
Beagle
9%
St. Bernard
9%
Yorkshire Terrier
9%
French Bulldog
9%
Border Collie
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality +10 points
Lunar Effect +10 points

Traits Breakdown

Body Corgi
Tail Boxer
Legs Rottweiler
Front Legs Beagle
Head St. Bernard
Ears Yorkshire Terrier
Snout French Bulldog
Mouth Rottweiler
Nose Border Collie
Eyes Grey Wolf
Color Shiba Inu