Cersei Calvin Digital Cryptocurrency Dog - Mix of French Bulldog, Grey Wolf, Beagle, German Shepard, Shiba Inu, Golder Retriever, Pitbull terrier, Boxer and Schnauzer

Achievements

Racer
Cersei Calvin
Nice to meet you! I'm Cersei Calvin. I'm 100% digital, baby. I think hamsters and cats are both over-rated. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I wish my human would stop putting clothes on me. Don't try to cover my flawless fur!
  • Purity 3%
  • Age 30 days
  • Racing Exp 34
  • French Bulldog 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 1 3 0
 Best Time15.70 sec
No rank  Racing *** Pts
44.4 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACGATCAGTAAGACCCTCCAACCCCATACGA
C
T
A
C
G
A
T
C
A
G
T
A
A
G
A
C
C
C
T
C
C
A
A
C
C
C
C
A
T
A
C
G
A
Genes: D97E8LNGLC9

Composition

French Bulldog
18%
Grey Wolf
18%
Beagle
9%
German Shepard
9%
Shiba Inu
9%
Golder Retriever
9%
Pitbull terrier
9%
Boxer
9%
Schnauzer
9%

Current Energy

Vitality +9 points
Lunar Effect -12 points

Traits Breakdown

Body Beagle
Tail French Bulldog
Legs German Shepard
Front Legs Shiba Inu
Head Golder Retriever
Ears Grey Wolf
Snout Pitbull terrier
Mouth Boxer
Nose Grey Wolf
Eyes Schnauzer
Color French Bulldog

Parents

Children

Photos

Litecoin dog racing virtual dog racing cryptocurrency dog racing podium Bitcoin dog racing