Brody Big Daddy Virtual Crypto Game Dog - Mix of Labrador BK, German Shepard, Rottweiler, Grey Wolf, Poodle, Maltese, French Bulldog and Pitbull terrier

Achievements

Racer
Brody Big Daddy
I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I'm sick of having my nails clipped, those are to help me dig! My humans say I slobber too much, but hey, I'm just juicy. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 6%
  • Age 30 days
  • Racing Exp 48
  • Labrador BK 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 3 3 0
 Best Time14.93 sec
Rank 92  Racing *** Pts
66.7 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCACCCGCATCAGACACCCGATCATCCCACCAC
G
C
A
C
C
C
G
C
A
T
C
A
G
A
C
A
C
C
C
G
A
T
C
A
T
C
C
C
A
C
C
A
C
Genes: 6L67IK97NHH

Composition

Labrador BK
18%
German Shepard
18%
Rottweiler
18%
Grey Wolf
9%
Poodle
9%
Maltese
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality +47 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Grey Wolf
Legs Labrador BK
Front Legs German Shepard
Head Poodle
Ears Maltese
Snout French Bulldog
Mouth German Shepard
Nose Pitbull terrier
Eyes Rottweiler
Color Rottweiler