Luke Skywalker Lando Digital Cryptocurrency Dog - Mix of Boxer, Maltese, St. Bernard, Shiba Inu, Golder Retriever, Rottweiler, French Bulldog, Labrador BK and Grey Wolf

Achievements

Racer
Podium Champion
Luke Skywalker Lando
They call me Luke Skywalker Lando. What's your name? My favorite sport is catching treats my human throws! Trust me. Leashes, collar and whips can be fun if you know what you're doing. My humans should try spending 8 hours a day in a crate! I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go.
  • Purity 3%
  • Age 30 days
  • Racing Exp 28
  • Boxer 18%
  • 10 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 1 1 1
 Best Time14.75 sec
No rank  Racing *** Pts
30.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACTGAGTAAGACACCGAGCAACCAACCCCACC
A
A
C
T
G
A
G
T
A
A
G
A
C
A
C
C
G
A
G
C
A
A
C
C
A
A
C
C
C
C
A
C
C
Genes: GBE8H96KGLK

Composition

Boxer
18%
Maltese
18%
St. Bernard
9%
Shiba Inu
9%
Golder Retriever
9%
Rottweiler
9%
French Bulldog
9%
Labrador BK
9%
Grey Wolf
9%

Current Energy

Vitality +14 points
Lunar Effect -2 points

Traits Breakdown

Body Boxer
Tail St. Bernard
Legs Shiba Inu
Front Legs Golder Retriever
Head Rottweiler
Ears French Bulldog
Snout Labrador BK
Mouth Maltese
Nose Boxer
Eyes Grey Wolf
Color Maltese