Dutches Dante Litecoin Dog - Mix of Border Collie, Boxer, Corgi, Labrador BK, Poodle, Pug, Rottweiler and Maltese

Achievements

Racer
Dutches Dante
Ima cyber dog. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I like nibbling on most everything, but I'll bite if you want me to. Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 6%
  • Age 15 months
  • Racing Exp 42
  • Border Collie 18%
  • 9 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 3 2 0
 Best Time15.47 sec
No rank  Racing *** Coins
55.6 % wins (5) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATACAACAGCAGCAACTACGACGAACACACC
G
C
A
T
A
C
A
A
C
A
G
C
A
G
C
A
A
C
T
A
C
G
A
C
G
A
A
C
A
C
A
C
C
Genes: 6JGOOGJI2HK

Composition

Border Collie
18%
Boxer
18%
Corgi
18%
Labrador BK
9%
Poodle
9%
Pug
9%
Rottweiler
9%
Maltese
9%

Current Energy

Vitality -35 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Boxer
Front Legs Corgi
Head Corgi
Ears Boxer
Snout Border Collie
Mouth Poodle
Nose Pug
Eyes Rottweiler
Color Maltese