Dutches Dante Litecoin Dog - Mix of Border Collie, Boxer, Corgi, Labrador BK, Poodle, Pug, Rottweiler and Maltese

Achievements

Racer
Dutches Dante
Ima cyber dog. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I like nibbling on most everything, but I'll bite if you want me to. Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 6%
  • Age 29 days
  • Racing Exp 41
  • Border Collie 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 3 2 0
 Best Time15.47 sec
No rank  Racing *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATACAACAGCAGCAACTACGACGAACACACC
G
C
A
T
A
C
A
A
C
A
G
C
A
G
C
A
A
C
T
A
C
G
A
C
G
A
A
C
A
C
A
C
C
Genes: 6JGOOGJI2HK

Composition

Border Collie
18%
Boxer
18%
Corgi
18%
Labrador BK
9%
Poodle
9%
Pug
9%
Rottweiler
9%
Maltese
9%

Current Energy

Vitality +25 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Boxer
Front Legs Corgi
Head Corgi
Ears Boxer
Snout Border Collie
Mouth Poodle
Nose Pug
Eyes Rottweiler
Color Maltese

Parents

Children

Photos

Bitcoin dog race online dog race podium Litecoin canine race photo online canine racing podium online dog race results