Sonya Blade Sarge Cryptocurrency Game Dog - Mix of Husky, Beagle, Dachshund, Labrador, Labrador BK, Border Collie, Pug, Yorkshire Terrier, Poodle, Corgi and St. Bernard

Achievements

None
Sonya Blade Sarge
Hey! My name's Sonya Blade Sarge! Someday I'm gonna breakout from inside this server. Chasing anything that will run is so much fun, I could do that all day. I am not above stealing food off humans' plates. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks...
  • Purity 0%
  • Age 31 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACACTAGGACCAGCATACGAATTAGACAGCTGA
A
C
A
C
T
A
G
G
A
C
C
A
G
C
A
T
A
C
G
A
A
T
T
A
G
A
C
A
G
C
T
G
A
Genes: 4DA56J2FIOB

Composition

Husky
9%
Beagle
9%
Dachshund
9%
Labrador
9%
Labrador BK
9%
Border Collie
9%
Pug
9%
Yorkshire Terrier
9%
Poodle
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality +31 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Beagle
Legs Dachshund
Front Legs Labrador
Head Labrador BK
Ears Border Collie
Snout Pug
Mouth Yorkshire Terrier
Nose Poodle
Eyes Corgi
Color St. Bernard