Chewbarka Chevy Crypto Dog - Mix of Maltese, Golder Retriever, French Bulldog, Corgi, Grey Wolf, Rottweiler, Husky, Border Collie and Poodle

Achievements

Racer
Podium Champion
Chewbarka Chevy
I live in your digital dreams. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! My favorite sport is catching treats my human throws! I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate!
  • Purity 4%
  • Age 29 days
  • Racing Exp 40
  • Maltese 27%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 3 1 1
 Best Time15.83 sec
Rank 93  Racing *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACGAACCAGCACCCCCCACACATACGACACC
A
G
A
C
G
A
A
C
C
A
G
C
A
C
C
C
C
C
C
A
C
A
C
A
T
A
C
G
A
C
A
C
C
Genes: 89KOKLH4JIK

Composition

Maltese
27%
Golder Retriever
9%
French Bulldog
9%
Corgi
9%
Grey Wolf
9%
Rottweiler
9%
Husky
9%
Border Collie
9%
Poodle
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail French Bulldog
Legs Maltese
Front Legs Corgi
Head Maltese
Ears Grey Wolf
Snout Rottweiler
Mouth Husky
Nose Border Collie
Eyes Poodle
Color Maltese

Parents

Children

Photos

Litecoin dog race Bitcoin doggy racing Litecoin canine race photo online pet racing podium virtual dog racing