Napoleon Natasha Litecoin Dog - Mix of St. Bernard, Poodle, Pug, Boxer, Husky, Maltese and Grey Wolf

Achievements

Racer
Napoleon Natasha
Howdy potential partner! Napoleon Natasha here. My bark alone scares birds out of my yard. Oh, go ahead. Pet me. I know you want to. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 9%
  • Age 29 days
  • Racing Exp 45
  • St. Bernard 27%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 1 5 0
 Best Time15.23 sec
Rank 85  Racing *** Pts
75.0 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACACAGACACCGAATGACCCTGATGAGACGAA
A
A
C
A
C
A
G
A
C
A
C
C
G
A
A
T
G
A
C
C
C
T
G
A
T
G
A
G
A
C
G
A
A
Genes: G4IK2BLBBI2

Composition

St. Bernard
27%
Poodle
18%
Pug
18%
Boxer
9%
Husky
9%
Maltese
9%
Grey Wolf
9%

Current Energy

Vitality +5 points
Lunar Effect -8 points

Traits Breakdown

Body Boxer
Tail Husky
Legs Poodle
Front Legs Maltese
Head Pug
Ears St. Bernard
Snout Grey Wolf
Mouth St. Bernard
Nose St. Bernard
Eyes Poodle
Color Pug