Napoleon Nona Cryptocurrency Game Dog - Mix of Border Collie, Boxer, Labrador BK, Labrador, Pitbull terrier, Grey Wolf, French Bulldog and Maltese

Achievements

Racer
Podium Champion
Napoleon Nona
I like to work out by digging fresh holes in landscaped yards. I hate not being allowed to hunt treasure in the garbage. It smells so good! I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I love it when you show a little teeth.
  • Purity 4%
  • Age 31 days
  • Racing Exp 37
  • Border Collie 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 2 2 1
 Best Time15.27 sec
No rank  Racing *** Pts
83.3 % wins (5) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CCATACAACTCCGCAAACCCCCGAACCTACGCA
C
C
A
T
A
C
A
A
C
T
C
C
G
C
A
A
A
C
C
C
C
C
G
A
A
C
C
T
A
C
G
C
A
Genes: 5JGN6GL9KJ6

Composition

Border Collie
18%
Boxer
18%
Labrador BK
18%
Labrador
9%
Pitbull terrier
9%
Grey Wolf
9%
French Bulldog
9%
Maltese
9%

Current Energy

Vitality +31 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Border Collie
Legs Boxer
Front Legs Pitbull terrier
Head Labrador BK
Ears Boxer
Snout Grey Wolf
Mouth French Bulldog
Nose Maltese
Eyes Border Collie
Color Labrador BK