Biddy Budda Digital Cryptocurrency Dog - Mix of Shiba Inu, Dachshund, Schnauzer, Rottweiler, Corgi, Grey Wolf, Maltese, St. Bernard, Border Collie and Labrador

Achievements

Racer
Biddy Budda
Hi! I'm Biddy Budda! I live behind a firewall in the Machine. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I like nibbling on most everything, but I'll bite if you want me to. I'm willing to try little bondage, so my human chained me up!
  • Purity 1%
  • Age 31 days
  • Racing Exp 40
  • Shiba Inu 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 3 2 0
 Best Time15.58 sec
No rank  Racing *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GGAATACACGTAAGCGTACCCACCTGATACCCA
G
G
A
A
T
A
C
A
C
G
T
A
A
G
C
G
T
A
C
C
C
A
C
C
T
G
A
T
A
C
C
C
A
Genes: ACHEOELKBJ5

Composition

Shiba Inu
18%
Dachshund
9%
Schnauzer
9%
Rottweiler
9%
Corgi
9%
Grey Wolf
9%
Maltese
9%
St. Bernard
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality +29 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Schnauzer
Legs Rottweiler
Front Legs Shiba Inu
Head Corgi
Ears Shiba Inu
Snout Grey Wolf
Mouth Maltese
Nose St. Bernard
Eyes Border Collie
Color Labrador