Allie Airmail Crypto Dog - Mix of Pitbull terrier, Schnauzer, St. Bernard, Grey Wolf, German Shepard, Poodle, Labrador and Corgi

Achievements

Racer
Allie Airmail
Yo! I'm Allie Airmail and I'd like to rock your world. My favorite song is "Who Let the Dogs Out?" It was me :) Sometimes I forget where I buried my bone. I really enjoy heavy petting. I'm not into dog collars, unless you're into S & M. I'm not looking to hook up forever, just to have a little fun.
  • Purity 8%
  • Age 29 days
  • Racing Exp 27
  • Pitbull terrier 27%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 3 0 0
 Best Time14.63 sec
Rank 20  Racing *** Pts
50.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGACCCTCCTCCTCAATAGACCCAATATCCAGC
T
G
A
C
C
C
T
C
C
T
C
C
T
C
A
A
T
A
G
A
C
C
C
A
A
T
A
T
C
C
A
G
C
Genes: BLNN7CI5CNO

Composition

Pitbull terrier
27%
Schnauzer
18%
St. Bernard
9%
Grey Wolf
9%
German Shepard
9%
Poodle
9%
Labrador
9%
Corgi
9%

Current Energy

Vitality +12 points
Lunar Effect +4 points

Traits Breakdown

Body St. Bernard
Tail Grey Wolf
Legs Pitbull terrier
Front Legs Pitbull terrier
Head German Shepard
Ears Schnauzer
Snout Poodle
Mouth Labrador
Nose Schnauzer
Eyes Pitbull terrier
Color Corgi

Parents

Children

Photos

virtual canine race podium virtual pet racing virtual doggy racing