Jasmine Joan Of Arc Litecoin Dog - Mix of Yorkshire Terrier, St. Bernard, Pitbull terrier, Labrador, Dachshund, Grey Wolf, French Bulldog, Schnauzer, Poodle and Beagle

Achievements

Racer
Podium Champion
Jasmine Joan Of Arc
What's up, pup? Name's Jasmine Joan Of Arc. Currently, I live on the information superhighway. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I just want to share a ball with someone, if you know what I mean...
  • Purity 1%
  • Age 31 days
  • Racing Exp 39
  • Yorkshire Terrier 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 2 2 1
 Best Time15.88 sec
No rank  Racing *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TGATCCCCATTAGGATTACCCCGAATAGACCTA
T
G
A
T
C
C
C
C
A
T
T
A
G
G
A
T
T
A
C
C
C
C
G
A
A
T
A
G
A
C
C
T
A
Genes: BN5FAFL9CID

Composition

Yorkshire Terrier
18%
St. Bernard
9%
Pitbull terrier
9%
Labrador
9%
Dachshund
9%
Grey Wolf
9%
French Bulldog
9%
Schnauzer
9%
Poodle
9%
Beagle
9%

Current Energy

Vitality +6 points
Lunar Effect -8 points

Traits Breakdown

Body St. Bernard
Tail Pitbull terrier
Legs Labrador
Front Legs Yorkshire Terrier
Head Dachshund
Ears Yorkshire Terrier
Snout Grey Wolf
Mouth French Bulldog
Nose Schnauzer
Eyes Poodle
Color Beagle

Parents

No Children

Photos

crypto doggy racing crypto pet racing crypto doggy race virtual pet racing cryptocurrency doggy race results