Wesley Willow Cryptocurrency Dog - Mix of Boxer, Labrador, Schnauzer, Rottweiler, Labrador BK, German Shepard and Golder Retriever

Achievements

Racer
Wesley Willow
Hi, I'm Wesley Willow. I adore sleeping upside down with my tongue hanging out! I could spend days on end chasing my tail. I get so close but it's just so fast! I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house?
  • Purity 6%
  • Age 31 days
  • Racing Exp 48
  • Boxer 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 5 1 0
 Best Time14.48 sec
No rank  Racing *** Pts
85.7 % wins (6) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GCAAACTCACCAATAAGACACCCAATACACAAC
G
C
A
A
A
C
T
C
A
C
C
A
A
T
A
A
G
A
C
A
C
C
C
A
A
T
A
C
A
C
A
A
C
Genes: 6G75C8H5CHG

Composition

Boxer
18%
Labrador
18%
Schnauzer
18%
Rottweiler
18%
Labrador BK
9%
German Shepard
9%
Golder Retriever
9%

Current Energy

Vitality +46 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Boxer
Legs German Shepard
Front Legs Labrador
Head Schnauzer
Ears Golder Retriever
Snout Rottweiler
Mouth Labrador
Nose Schnauzer
Eyes Rottweiler
Color Boxer

Parents

No Children

Photos

cryptocurrency dog racing photo Litecoin doggy racing Litecoin dog race results online dog race results virtual canine racing results Litecoin dog racing podium