Wesley Willow Cryptocurrency Dog - Mix of Boxer, Labrador, Schnauzer, Rottweiler, Labrador BK, German Shepard and Golder Retriever

Achievements

Racer
Wesley Willow
Hi, I'm Wesley Willow. I adore sleeping upside down with my tongue hanging out! I could spend days on end chasing my tail. I get so close but it's just so fast! I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house?
  • Purity 6%
  • Age 12 months
  • Racing Exp 56
  • Boxer 18%
  • 8 races
  • Gen 0
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 6 1 0
 Best Time14.48 sec
No rank  Racing *** Coins
87.5 % wins (7) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAACTCACCAATAAGACACCCAATACACAAC
G
C
A
A
A
C
T
C
A
C
C
A
A
T
A
A
G
A
C
A
C
C
C
A
A
T
A
C
A
C
A
A
C
Genes: 6G75C8H5CHG

Composition

Boxer
18%
Labrador
18%
Schnauzer
18%
Rottweiler
18%
Labrador BK
9%
German Shepard
9%
Golder Retriever
9%

Current Energy

Vitality -13 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Boxer
Legs German Shepard
Front Legs Labrador
Head Schnauzer
Ears Golder Retriever
Snout Rottweiler
Mouth Labrador
Nose Schnauzer
Eyes Rottweiler
Color Boxer