Drew Deanna

I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm into recreational spankings and a little 'ruff' play. Oh, go ahead. Pet me. I know you want to. If you have fleas or ticks, don't bother.

Purity 8%
Age 12 months
Racing Exp 54

Husky 18%
8 races
Gen 0

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats


8 races \| 5 1 1	Best Time	14.08 sec
No rank	Racing	*** Coins
87.5 % wins (7)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: ACATACTACTCAATAGAACGAGAAGACGCAACA

Genes: 4JJ7C292I64

Composition

Husky	18%
Border Collie	18%
Pug	18%
German Shepard	9%
Schnauzer	9%
French Bulldog	9%
Poodle	9%
Labrador BK	9%

Current Energy

Vitality	-9 points
Lunar Effect	-4 points

Traits Breakdown

Body	Husky
Tail	Border Collie
Legs	Border Collie
Front Legs	German Shepard
Head	Schnauzer
Ears	Pug
Snout	French Bulldog
Mouth	Pug
Nose	Poodle
Eyes	Labrador BK
Color	Husky

Parents

Satoshi the Unicorn

Children

Photos

Achievements