Drew Deanna Cryptocurrency Dog - Mix of Husky, Border Collie, Pug, German Shepard, Schnauzer, French Bulldog, Poodle and Labrador BK

Achievements

Racer
Podium Champion
Drew Deanna
I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm into recreational spankings and a little 'ruff' play. Oh, go ahead. Pet me. I know you want to. If you have fleas or ticks, don't bother.
  • Purity 8%
  • Age 12 months
  • Racing Exp 54
  • Husky 18%
  • 8 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 5 1 1
 Best Time14.08 sec
No rank  Racing *** Coins
87.5 % wins (7) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATACTACTCAATAGAACGAGAAGACGCAACA
A
C
A
T
A
C
T
A
C
T
C
A
A
T
A
G
A
A
C
G
A
G
A
A
G
A
C
G
C
A
A
C
A
Genes: 4JJ7C292I64

Composition

Husky
18%
Border Collie
18%
Pug
18%
German Shepard
9%
Schnauzer
9%
French Bulldog
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality -9 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Border Collie
Legs Border Collie
Front Legs German Shepard
Head Schnauzer
Ears Pug
Snout French Bulldog
Mouth Pug
Nose Poodle
Eyes Labrador BK
Color Husky