Madeline Mulan Cryptocurrency Game Dog - Mix of Grey Wolf, Golder Retriever, Pitbull terrier, Dachshund, Labrador, Poodle, Husky, St. Bernard and Rottweiler

Achievements

Racer
Madeline Mulan
I love a good book... I find them quite tasty. I don't like having to stay off the furniture. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 3%
  • Age 31 days
  • Racing Exp 34
  • Grey Wolf 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 4 0 0
 Best Time15.57 sec
Rank 72  Racing *** Pts
66.7 % wins (4) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CCCTCCGGACCACCCGACACAAGATGAAGACAC
C
C
C
T
C
C
G
G
A
C
C
A
C
C
C
G
A
C
A
C
A
A
G
A
T
G
A
A
G
A
C
A
C
Genes: LNA5LI48B8H

Composition

Grey Wolf
18%
Golder Retriever
18%
Pitbull terrier
9%
Dachshund
9%
Labrador
9%
Poodle
9%
Husky
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality +41 points
Lunar Effect -16 points

Traits Breakdown

Body Grey Wolf
Tail Pitbull terrier
Legs Dachshund
Front Legs Labrador
Head Grey Wolf
Ears Poodle
Snout Husky
Mouth Golder Retriever
Nose St. Bernard
Eyes Golder Retriever
Color Rottweiler