Caesar Callisto Litecoin Game Dog - Mix of Pitbull terrier, Grey Wolf, St. Bernard, Husky, Poodle, Maltese, Beagle and Rottweiler

Achievements

Racer
Caesar Callisto
I'm Caesar Callisto. What do they call you? Fences are just challenges...I don't let them stop me! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.
  • Purity 6%
  • Age 31 days
  • Racing Exp 27
  • Pitbull terrier 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 2 1 0
 Best Time14.87 sec
No rank  Racing *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ACAGACACCTCCCCCCTATCCCCCCACTGATGA
A
C
A
G
A
C
A
C
C
T
C
C
C
C
C
C
T
A
T
C
C
C
C
C
C
A
C
T
G
A
T
G
A
Genes: 4IKNLDNLHBB

Composition

Pitbull terrier
18%
Grey Wolf
18%
St. Bernard
18%
Husky
9%
Poodle
9%
Maltese
9%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality +14 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Maltese
Front Legs Pitbull terrier
Head Grey Wolf
Ears Beagle
Snout Pitbull terrier
Mouth Grey Wolf
Nose Rottweiler
Eyes St. Bernard
Color St. Bernard

Parents

Children

Photos

cryptocurrency dog race podium Bitcoin canine race results Bitcoin dog race results