Bruce Beanie Litecoin Dog - Mix of Corgi, Grey Wolf, Beagle, Pug, St. Bernard, Border Collie, Yorkshire Terrier, Maltese and Schnauzer

Achievements

Racer
Bruce Beanie
Hey! My name's Bruce Beanie! I enjoy exploration and am game for anything doggy-style. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! My favorite treat is to steal the pepperoni off of pizza.
  • Purity 3%
  • Age 31 days
  • Racing Exp 39
  • Corgi 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 3 2 0
 Best Time15.03 sec
Rank 21  Racing *** Pts
83.3 % wins (5) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: AGCCCCCTAGAATGACCCTACAGCTTAACCATA
A
G
C
C
C
C
C
T
A
G
A
A
T
G
A
C
C
C
T
A
C
A
G
C
T
T
A
A
C
C
A
T
A
Genes: OLD2BLJOFKC

Composition

Corgi
18%
Grey Wolf
18%
Beagle
9%
Pug
9%
St. Bernard
9%
Border Collie
9%
Yorkshire Terrier
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -12 points
Lunar Effect +6 points

Traits Breakdown

Body Corgi
Tail Grey Wolf
Legs Beagle
Front Legs Pug
Head St. Bernard
Ears Grey Wolf
Snout Border Collie
Mouth Corgi
Nose Yorkshire Terrier
Eyes Maltese
Color Schnauzer

Parents

Children

Photos

cryptocurrency dog racing podium crypto pet race virtual dog race Bitcoin dog racing cryptocurrency canine race