Epona Emmy Digital Cryptocurrency Game Dog - Mix of Boxer, Maltese, Golder Retriever, French Bulldog, St. Bernard, Yorkshire Terrier and Pug

Achievements

Racer
Podium Champion
Epona Emmy
Small yappy creatures bug me...they disturb my zen. I'm always up for some puppy action, is that wrong? My favorite sport is catching treats my human throws! I am really into starting howling wars with the neighborhood dogs. I'm the loudest!
  • Purity 14%
  • Age 29 days
  • Racing Exp 38
  • Boxer 36%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 2 2 1
 Best Time14.50 sec
No rank  Racing *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACGAACCAACTGAAACAACAACACCTTAGAA
A
G
A
C
G
A
A
C
C
A
A
C
T
G
A
A
A
C
A
A
C
A
A
C
A
C
C
T
T
A
G
A
A
Genes: 89KGBGGGKF2

Composition

Boxer
36%
Maltese
18%
Golder Retriever
9%
French Bulldog
9%
St. Bernard
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality +16 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail French Bulldog
Legs Maltese
Front Legs Boxer
Head St. Bernard
Ears Boxer
Snout Boxer
Mouth Boxer
Nose Maltese
Eyes Yorkshire Terrier
Color Pug

Parents

Children

Photos

virtual pet race podium virtual dog racing photo Litecoin canine racing crypto pet racing virtual dog race podium