Hershey Hailey Litecoin Game Dog - Mix of Grey Wolf, Pitbull terrier, Golder Retriever, Boxer, Labrador, Husky, Dachshund and Beagle

Achievements

Racer
Hershey Hailey
I answer to 'Hershey Hailey'. I live in cyberspace. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I just want a snuggle buddy with a nice, soft coat.
  • Purity 6%
  • Age 31 days
  • Racing Exp 26
  • Grey Wolf 27%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 2 0 1
 Best Time15.22 sec
No rank  Racing *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CCCTCCAGAAACCCCCCATCCACAGGACCCCTA
C
C
C
T
C
C
A
G
A
A
A
C
C
C
C
C
C
A
T
C
C
A
C
A
G
G
A
C
C
C
C
T
A
Genes: LN8GL5N4ALD

Composition

Grey Wolf
27%
Pitbull terrier
18%
Golder Retriever
9%
Boxer
9%
Labrador
9%
Husky
9%
Dachshund
9%
Beagle
9%

Current Energy

Vitality +32 points
Lunar Effect -16 points

Traits Breakdown

Body Grey Wolf
Tail Pitbull terrier
Legs Golder Retriever
Front Legs Boxer
Head Grey Wolf
Ears Labrador
Snout Pitbull terrier
Mouth Husky
Nose Dachshund
Eyes Grey Wolf
Color Beagle