Chiquita Clover Digital Cryptocurrency Dog - Mix of Yorkshire Terrier, Shiba Inu, Corgi, Labrador, Border Collie, Grey Wolf, French Bulldog, Golder Retriever and Pug

Achievements

Racer
Chiquita Clover
I live in cyberspace where you can turn me on. My favorite position is doggie style ;) I'm always up for some puppy action, is that wrong? I'm the best at running circle 8's. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff.
  • Purity 3%
  • Age 29 days
  • Racing Exp 27
  • Yorkshire Terrier 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 2 1 0
 Best Time15.65 sec
Rank 81  Racing *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAAGCCCATACGTACCCTTAGTACGAAGAGAA
T
T
A
A
G
C
C
C
A
T
A
C
G
T
A
C
C
C
T
T
A
G
T
A
C
G
A
A
G
A
G
A
A
Genes: FO5JELFE982

Composition

Yorkshire Terrier
18%
Shiba Inu
18%
Corgi
9%
Labrador
9%
Border Collie
9%
Grey Wolf
9%
French Bulldog
9%
Golder Retriever
9%
Pug
9%

Current Energy

Vitality +35 points
Lunar Effect +2 points

Traits Breakdown

Body Yorkshire Terrier
Tail Corgi
Legs Labrador
Front Legs Border Collie
Head Shiba Inu
Ears Grey Wolf
Snout Yorkshire Terrier
Mouth Shiba Inu
Nose French Bulldog
Eyes Golder Retriever
Color Pug