Jetta Joplin Litecoin Dog - Mix of Shiba Inu, St. Bernard, Husky, Poodle, German Shepard, Corgi, Labrador, Border Collie and Maltese

Achievements

Racer
TOP 10 Fastest
Jetta Joplin
Hullo. My name is Jetta Joplin. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! Little Bow Wow is my favorite musician. I just assume he's a dog... I am not above stealing food off humans' plates.
  • Purity 3%
  • Age 29 days
  • Racing Exp 40
  • Shiba Inu 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 4 0 1
 Best Time14.15 sec
Rank 2  Racing *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATGAACAGACTCAAGCGTACCATACTGAACC
G
T
A
T
G
A
A
C
A
G
A
C
T
C
A
A
G
C
G
T
A
C
C
A
T
A
C
T
G
A
A
C
C
Genes: EB4I7OE5JBK

Composition

Shiba Inu
18%
St. Bernard
18%
Husky
9%
Poodle
9%
German Shepard
9%
Corgi
9%
Labrador
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality +37 points
Lunar Effect -2 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Husky
Front Legs Poodle
Head German Shepard
Ears Corgi
Snout Shiba Inu
Mouth Labrador
Nose Border Collie
Eyes St. Bernard
Color Maltese

Parents

No Children

Photos

online dog race results cryptocurrency dog racing cryptocurrency doggy racing crypto canine racing photo cryptocurrency canine race