Kenzi Katz Litecoin Dog - Mix of Labrador BK, Beagle, Rottweiler, Border Collie, St. Bernard and Shiba Inu

Achievements

Racer
Kenzi Katz
When I hook up, I stay hooked up for about 20 minutes. Rolling around on the carpet after a bath is my favorite way to dry. I hate it when other dogs pee in my yard! IT'S MY YARD!! It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 17%
  • Age 31 days
  • Racing Exp 11
  • Labrador BK 36%
  • 4 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 1 0 0
 Best Time15.73 sec
Rank 78  Racing *** Pts
25.0 % wins (1) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TACCTACTAGCAGCATGACACGTAGCAGCACAC
T
A
C
C
T
A
C
T
A
G
C
A
G
C
A
T
G
A
C
A
C
G
T
A
G
C
A
G
C
A
C
A
C
Genes: JDD66BHE66H

Composition

Labrador BK
36%
Beagle
18%
Rottweiler
18%
Border Collie
9%
St. Bernard
9%
Shiba Inu
9%

Current Energy

Vitality +27 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Beagle
Legs Beagle
Front Legs Labrador BK
Head Labrador BK
Ears St. Bernard
Snout Rottweiler
Mouth Shiba Inu
Nose Labrador BK
Eyes Labrador BK
Color Rottweiler