Peanut Poppy Litecoin Dog - Mix of Poodle, Dachshund, Husky, Labrador, French Bulldog, Grey Wolf and Rottweiler

Achievements

Racer
Peanut Poppy
This dawg chases mice in a big data warehouse. My favorite position is doggie style ;) I never knew my father. I enjoy exploration and am game for anything doggy-style. I'm not into dog collars, unless you're into S & M. I want a mate that knows how to give a proper belly rub!
  • Purity 9%
  • Age 32 days
  • Racing Exp 16
  • Poodle 27%
  • 4 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 1 0 1
 Best Time16.63 sec
No rank  Racing *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGACGACCCAACACGAGGAGACCCCACACAC
G
G
A
G
A
C
G
A
C
C
C
A
A
C
A
C
G
A
G
G
A
G
A
C
C
C
C
A
C
A
C
A
C
Genes: AII549AIL4H

Composition

Poodle
27%
Dachshund
18%
Husky
18%
Labrador
9%
French Bulldog
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality +29 points
Lunar Effect -22 points

Traits Breakdown

Body Dachshund
Tail Poodle
Legs Poodle
Front Legs Labrador
Head Husky
Ears French Bulldog
Snout Dachshund
Mouth Poodle
Nose Grey Wolf
Eyes Husky
Color Rottweiler

Parents

No Children

Photos

virtual pet race Bitcoin dog racing