Bolt Buffie Litecoin Game Dog - Mix of Beagle, Grey Wolf, Corgi, Poodle, Border Collie, French Bulldog, Pug, Shiba Inu and Golder Retriever

Achievements

Racer
Bolt Buffie
The Ethernet where I live, rocks. It doesn't matter to me which team I play for... I just like tail. I don't like having to stay in the car when my people go inside. My favorite chews are underwear and rawhide...the rawhide lasts longer. My humans say I slobber too much, but hey, I'm just juicy.
  • Purity 3%
  • Age 31 days
  • Racing Exp 9
  • Beagle 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 1 0
 Best Time15.88 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCGACTACCTACGAGAACCCCTAGTAAGACCC
A
G
C
G
A
C
T
A
C
C
T
A
C
G
A
G
A
A
C
C
C
C
T
A
G
T
A
A
G
A
C
C
C
Genes: OIJD92LDE8L

Composition

Beagle
18%
Grey Wolf
18%
Corgi
9%
Poodle
9%
Border Collie
9%
French Bulldog
9%
Pug
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality +14 points
Lunar Effect -18 points

Traits Breakdown

Body Corgi
Tail Poodle
Legs Border Collie
Front Legs Beagle
Head French Bulldog
Ears Pug
Snout Grey Wolf
Mouth Beagle
Nose Shiba Inu
Eyes Golder Retriever
Color Grey Wolf

Parents

No Children

Photos

Litecoin dog race photo