Newton Nellie Cryptocurrency Game Dog - Mix of Rottweiler, Border Collie, Schnauzer, Labrador BK, Golder Retriever, Boxer, Poodle, Pug, Dachshund and Pitbull terrier

Achievements

Racer
Newton Nellie
What's up, pup? Name's Newton Nellie. I've always had a crush on Lassie. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. My turn-offs are rolled up newspapers and loud noises. Looking for that special tail wag.
  • Purity 1%
  • Age 31 days
  • Racing Exp 16
  • Rottweiler 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 1 0
 Best Time15.62 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTACATAGCAAGAAACGACGAAGGACACTCC
C
A
C
T
A
C
A
T
A
G
C
A
A
G
A
A
A
C
G
A
C
G
A
A
G
G
A
C
A
C
T
C
C
Genes: HJC68GI2AHN

Composition

Rottweiler
18%
Border Collie
9%
Schnauzer
9%
Labrador BK
9%
Golder Retriever
9%
Boxer
9%
Poodle
9%
Pug
9%
Dachshund
9%
Pitbull terrier
9%

Current Energy

Vitality +13 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Border Collie
Legs Schnauzer
Front Legs Labrador BK
Head Golder Retriever
Ears Boxer
Snout Poodle
Mouth Pug
Nose Dachshund
Eyes Rottweiler
Color Pitbull terrier

Parents

No Children

Photos

cryptocurrency dog racing podium crypto dog racing