Abigail Amber Bitcoin Dog - Mix of Pitbull terrier, Maltese, Pug, Beagle, Boxer, German Shepard, Rottweiler, Husky, Schnauzer and Poodle

Achievements

Racer
Abigail Amber
I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!
  • Purity 1%
  • Age 31 days
  • Racing Exp 15
  • Pitbull terrier 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 0 1
 Best Time16.30 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCACCGAACTAAACTCACACACAATATCCGAC
T
C
C
A
C
C
G
A
A
C
T
A
A
A
C
T
C
A
C
A
C
A
C
A
A
T
A
T
C
C
G
A
C
Genes: NK2DG7H4CNI

Composition

Pitbull terrier
18%
Maltese
9%
Pug
9%
Beagle
9%
Boxer
9%
German Shepard
9%
Rottweiler
9%
Husky
9%
Schnauzer
9%
Poodle
9%

Current Energy

Vitality -17 points
Lunar Effect +4 points

Traits Breakdown

Body Pitbull terrier
Tail Maltese
Legs Pug
Front Legs Beagle
Head Boxer
Ears German Shepard
Snout Rottweiler
Mouth Husky
Nose Schnauzer
Eyes Pitbull terrier
Color Poodle

Parents

No Children

Photos

online dog race photo virtual dog race podium