Grady Grace Crypto Game Dog - Mix of Beagle, Shiba Inu, Husky, St. Bernard, German Shepard, Pug, Grey Wolf, Schnauzer and Dachshund

Achievements

Racer
Grady Grace
Hi, Grady Grace is my name. Size matters. This dawg's into big databases. It doesn't matter to me which team I play for... I just like tail. I hate hiding under the bed during a thunder storm but that's just smart, right? I'm going kill that damn Nyan Cat if I can catch it.
  • Purity 3%
  • Age 4 months
  • Racing Exp 22
  • Beagle 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 1
3 races    Best Time16.83 sec
No rank  Racing *** Coins
100.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATGACTAGTATCAGTAGAACTACCCATAGGA
A
C
A
T
G
A
C
T
A
G
T
A
T
C
A
G
T
A
G
A
A
C
T
A
C
C
C
A
T
A
G
G
A
Genes: 4BDE7E2DLCA

Composition

Beagle
18%
Shiba Inu
18%
Husky
9%
St. Bernard
9%
German Shepard
9%
Pug
9%
Grey Wolf
9%
Schnauzer
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail St. Bernard
Legs Beagle
Front Legs Shiba Inu
Head German Shepard
Ears Shiba Inu
Snout Pug
Mouth Beagle
Nose Grey Wolf
Eyes Schnauzer
Color Dachshund