Ricky Rider Bitcoin Game Dog - Mix of Poodle, Rottweiler, Boxer, Grey Wolf, Maltese, Labrador, Pitbull terrier, Shiba Inu and Dachshund

Achievements

Racer
Ricky Rider
Hola! My name is Ricky Rider. I'm all about a hard drive because you can't do anything with a floppy disc. I hate it when my humans fool me with a pill in peanut butter! I'm into group dog piles, the more the better. If you are looking for companionship without commitment, keep looking.
  • Purity 5%
  • Age 29 days
  • Racing Exp 9
  • Poodle 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time16.72 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: AACCCCACCCCAGACGACCACTCCGTACACGGA
A
A
C
C
C
C
A
C
C
C
C
A
G
A
C
G
A
C
C
A
C
T
C
C
G
T
A
C
A
C
G
G
A
Genes: GLK5IIHNEHA

Composition

Poodle
18%
Rottweiler
18%
Boxer
9%
Grey Wolf
9%
Maltese
9%
Labrador
9%
Pitbull terrier
9%
Shiba Inu
9%
Dachshund
9%

Current Energy

Vitality +12 points
Lunar Effect +12 points

Traits Breakdown

Body Boxer
Tail Grey Wolf
Legs Maltese
Front Legs Labrador
Head Poodle
Ears Poodle
Snout Rottweiler
Mouth Pitbull terrier
Nose Shiba Inu
Eyes Rottweiler
Color Dachshund

Parents

No Children

Photos

Bitcoin doggy race