Ricky Rider Bitcoin Game Dog - Mix of Poodle, Rottweiler, Boxer, Grey Wolf, Maltese, Labrador, Pitbull terrier, Shiba Inu and Dachshund

Achievements

Racer
Ricky Rider
Hola! My name is Ricky Rider. I'm all about a hard drive because you can't do anything with a floppy disc. I hate it when my humans fool me with a pill in peanut butter! I'm into group dog piles, the more the better. If you are looking for companionship without commitment, keep looking.
  • Purity 5%
  • Age 15 months
  • Racing Exp 16
  • Poodle 18%
  • 3 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 1 0
 Best Time16.72 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCCCACCCCAGACGACCACTCCGTACACGGA
A
A
C
C
C
C
A
C
C
C
C
A
G
A
C
G
A
C
C
A
C
T
C
C
G
T
A
C
A
C
G
G
A
Genes: GLK5IIHNEHA

Composition

Poodle
18%
Rottweiler
18%
Boxer
9%
Grey Wolf
9%
Maltese
9%
Labrador
9%
Pitbull terrier
9%
Shiba Inu
9%
Dachshund
9%

Current Energy

Vitality -48 points
Lunar Effect -10 points

Traits Breakdown

Body Boxer
Tail Grey Wolf
Legs Maltese
Front Legs Labrador
Head Poodle
Ears Poodle
Snout Rottweiler
Mouth Pitbull terrier
Nose Shiba Inu
Eyes Rottweiler
Color Dachshund