Leia Lucy Crypto Dog - Mix of French Bulldog, Labrador BK, Maltese, Corgi, Grey Wolf, Golder Retriever, St. Bernard, Beagle and Pug

Achievements

Racer
Leia Lucy
Suh? How's it goin? I'm Leia Lucy. If I can't reach it to clean it myself, it doesn't need cleaning! My favorite song is "Who Let the Dogs Out?" It was me :) You know the worst? Watching my humans 'get it on' and I have to lick myself. Size doesn't matter, I like 'em all.
  • Purity 5%
  • Age 31 days
  • Racing Exp 13
  • French Bulldog 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 2
 Best Time17.08 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGAACCGCAAGCCCCAGATGACTAGAAGCACGA
C
G
A
A
C
C
G
C
A
A
G
C
C
C
C
A
G
A
T
G
A
C
T
A
G
A
A
G
C
A
C
G
A
Genes: 9K6OL8BD269

Composition

French Bulldog
18%
Labrador BK
18%
Maltese
9%
Corgi
9%
Grey Wolf
9%
Golder Retriever
9%
St. Bernard
9%
Beagle
9%
Pug
9%

Current Energy

Vitality +26 points
Lunar Effect -6 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs Labrador BK
Front Legs Corgi
Head Grey Wolf
Ears Golder Retriever
Snout St. Bernard
Mouth Beagle
Nose Pug
Eyes Labrador BK
Color French Bulldog

Parents

No Children

Photos

cryptocurrency canine racing virtual dog racing