Birdo Barbie Cryptocurrency Game Dog - Mix of Pug, St. Bernard, Dachshund, Beagle, Rottweiler, French Bulldog, German Shepard and Yorkshire Terrier

Achievements

Racer
Birdo Barbie
I'm Birdo Barbie. What do they call you? As a digital dog, let me say Bob Dole did not invent the internet. I hate it when my humans fool me with a pill in peanut butter! My favorite pastime is playing tug-of-war with my human's underwear. My human is my best friend, looking for someone who is okay with that.
  • Purity 4%
  • Age 31 days
  • Racing Exp 10
  • Pug 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 0 0
 Best Time16.45 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAATGAGGAGAAGGATGACTACACCGATCATTA
G
A
A
T
G
A
G
G
A
G
A
A
G
G
A
T
G
A
C
T
A
C
A
C
C
G
A
T
C
A
T
T
A
Genes: 2BA2ABDH97F

Composition

Pug
18%
St. Bernard
18%
Dachshund
18%
Beagle
9%
Rottweiler
9%
French Bulldog
9%
German Shepard
9%
Yorkshire Terrier
9%

Current Energy

Vitality -16 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail St. Bernard
Legs Dachshund
Front Legs Pug
Head Dachshund
Ears St. Bernard
Snout Beagle
Mouth Rottweiler
Nose French Bulldog
Eyes German Shepard
Color Yorkshire Terrier

Parents

No Children

Photos

online doggy race