Bandit Bullwinkle Litecoin Dog - Mix of Corgi, Grey Wolf, Shiba Inu, Labrador BK, Rottweiler, Boxer, Labrador and Schnauzer

Achievements

Racer
Bandit Bullwinkle
Hey, Baby. I'm Bandit Bullwinkle. I live in cyberspace. Eat, sleep, poop. Honey, I've got it made. I'm into recreational spankings and a little 'ruff' play. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house?
  • Purity 8%
  • Age 31 days
  • Racing Exp 18
  • Corgi 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 3
 Best Time16.85 sec
No rank  Racing *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGCACCCCACAACCCAAGCATAAGCAGCCCC
G
T
A
G
C
A
C
C
C
C
A
C
A
A
C
C
C
A
A
G
C
A
T
A
A
G
C
A
G
C
C
C
C
Genes: E6LHG5OCOOL

Composition

Corgi
27%
Grey Wolf
18%
Shiba Inu
9%
Labrador BK
9%
Rottweiler
9%
Boxer
9%
Labrador
9%
Schnauzer
9%

Current Energy

Vitality +29 points
Lunar Effect -2 points

Traits Breakdown

Body Shiba Inu
Tail Labrador BK
Legs Grey Wolf
Front Legs Rottweiler
Head Boxer
Ears Labrador
Snout Corgi
Mouth Schnauzer
Nose Corgi
Eyes Corgi
Color Grey Wolf

Parents

No Children

Photos

crypto canine race Bitcoin doggy race photo virtual dog race podium