Mlem Marie Digital Cryptocurrency Dog - Mix of Corgi, Grey Wolf, Yorkshire Terrier, St. Bernard, Pitbull terrier, German Shepard, Schnauzer and Poodle

Achievements

Racer
Mlem Marie
How YOU doin'? Mlem Marie here. I hate never catching that damn rabbit in my dreams. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I enjoy staying active, and running circles around puppies and young children.
  • Purity 4%
  • Age 31 days
  • Racing Exp 23
  • Corgi 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 2 1 0
 Best Time16.13 sec
No rank  Racing *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCTGACCCTCCTCACCCATAAGCTTAGACTTA
A
G
C
T
G
A
C
C
C
T
C
C
T
C
A
C
C
C
A
T
A
A
G
C
T
T
A
G
A
C
T
T
A
Genes: OBLN7LCOFIF

Composition

Corgi
18%
Grey Wolf
18%
Yorkshire Terrier
18%
St. Bernard
9%
Pitbull terrier
9%
German Shepard
9%
Schnauzer
9%
Poodle
9%

Current Energy

Vitality +30 points
Lunar Effect -2 points

Traits Breakdown

Body Corgi
Tail St. Bernard
Legs Grey Wolf
Front Legs Pitbull terrier
Head German Shepard
Ears Grey Wolf
Snout Schnauzer
Mouth Corgi
Nose Yorkshire Terrier
Eyes Poodle
Color Yorkshire Terrier

Parents

No Children

Photos

virtual pet race results crypto doggy race crypto dog racing podium