Panther Porkchop Litecoin Dog - Mix of Pug, Dachshund, German Shepard, St. Bernard, Corgi, Schnauzer, Border Collie, Grey Wolf and Rottweiler

Achievements

Racer
Panther Porkchop
My favorite treat is to steal the pepperoni off of pizza. I slept with a cat and I liked it. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I hate not being allowed to hunt treasure in the garbage. It smells so good!
  • Purity 3%
  • Age 31 days
  • Racing Exp 1
  • Pug 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.37 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATGAGAAAGCATAGGATACCCCGAACACGGA
T
C
A
T
G
A
G
A
A
A
G
C
A
T
A
G
G
A
T
A
C
C
C
C
G
A
A
C
A
C
G
G
A
Genes: 7B2OCAJL2HA

Composition

Pug
18%
Dachshund
18%
German Shepard
9%
St. Bernard
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality +11 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs Pug
Front Legs Corgi
Head Schnauzer
Ears Dachshund
Snout Border Collie
Mouth Grey Wolf
Nose Pug
Eyes Rottweiler
Color Dachshund

Parents

No Children

Photos