Mabel Mercy Crypto Dog - Mix of Border Collie, Rottweiler, Yorkshire Terrier, Grey Wolf, Schnauzer, French Bulldog, Pitbull terrier, Pug, Poodle and Husky

Achievements

None
Mabel Mercy
Mabel Mercy here. Wanna play? I run on the information superhighway and haven't been hit by a car yet. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I want to find a mate who enjoys dog parks as much as I do.
  • Purity 1%
  • Age 29 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CACTACTTACCCTACATACGATCCGAAGACACA
C
A
C
T
A
C
T
T
A
C
C
C
T
A
C
A
T
A
C
G
A
T
C
C
G
A
A
G
A
C
A
C
A
Genes: HJFLJC9N2I4

Composition

Border Collie
18%
Rottweiler
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Schnauzer
9%
French Bulldog
9%
Pitbull terrier
9%
Pug
9%
Poodle
9%
Husky
9%

Current Energy

Vitality +48 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Border Collie
Legs Yorkshire Terrier
Front Legs Grey Wolf
Head Border Collie
Ears Schnauzer
Snout French Bulldog
Mouth Pitbull terrier
Nose Pug
Eyes Poodle
Color Husky