Sassie Silvester Litecoin Dog - Mix of Grey Wolf, Golder Retriever, Husky, Yorkshire Terrier, Border Collie, Pug, French Bulldog, Schnauzer and Labrador BK

Achievements

Racer
Sassie Silvester
I am a guard dog for the data warehouse. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Shy dogs that tuck tail bore me. I want to find a mate who enjoys dog parks as much as I do.
  • Purity 7%
  • Age 31 days
  • Racing Exp 6
  • Grey Wolf 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time17.15 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATTATACGAACGACCCCCCATAGCAAGAAGA
A
C
A
T
T
A
T
A
C
G
A
A
C
G
A
C
C
C
C
C
C
A
T
A
G
C
A
A
G
A
A
G
A
Genes: 4FJ29LLC688

Composition

Grey Wolf
18%
Golder Retriever
18%
Husky
9%
Yorkshire Terrier
9%
Border Collie
9%
Pug
9%
French Bulldog
9%
Schnauzer
9%
Labrador BK
9%

Current Energy

Vitality +13 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Border Collie
Front Legs Pug
Head French Bulldog
Ears Grey Wolf
Snout Grey Wolf
Mouth Schnauzer
Nose Labrador BK
Eyes Golder Retriever
Color Golder Retriever