Barbie Baraka Crypto Game Dog - Mix of Maltese, Boxer, Golder Retriever, Beagle, Grey Wolf, St. Bernard, Border Collie, Pitbull terrier and Pug

Achievements

Racer
Barbie Baraka
Salutations! My name's Barbie Baraka. Watching kids play without me is the worst, no? My humans say I bark too much, but I have a lot to say! I love the smell of freshly cut grass. I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 5%
  • Age 15 months
  • Racing Exp 8
  • Maltese 18%
  • 1 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time17.03 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCACCAACAGACTACCCTGATACTCCGAAAAC
A
C
C
A
C
C
A
A
C
A
G
A
C
T
A
C
C
C
T
G
A
T
A
C
T
C
C
G
A
A
A
A
C
Genes: KKG8DLBJN2G

Composition

Maltese
18%
Boxer
18%
Golder Retriever
9%
Beagle
9%
Grey Wolf
9%
St. Bernard
9%
Border Collie
9%
Pitbull terrier
9%
Pug
9%

Current Energy

Vitality -58 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Maltese
Legs Boxer
Front Legs Golder Retriever
Head Beagle
Ears Grey Wolf
Snout St. Bernard
Mouth Border Collie
Nose Pitbull terrier
Eyes Pug
Color Boxer