Abbott Arnie Bitcoin Dog - Mix of German Shepard, Maltese, Boxer, Schnauzer, Beagle, Rottweiler, French Bulldog, Husky and Grey Wolf

Achievements

None
Abbott Arnie
I love a good book... I find them quite tasty. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I've been known to run with bad dogs. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 5%
  • Age 29 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: AACATACTACACTCATCACGAACCACACCCACC
A
A
C
A
T
A
C
T
A
C
A
C
T
C
A
T
C
A
C
G
A
A
C
C
A
C
A
C
C
C
A
C
C
Genes: GCDH779K4LK

Composition

German Shepard
18%
Maltese
18%
Boxer
9%
Schnauzer
9%
Beagle
9%
Rottweiler
9%
French Bulldog
9%
Husky
9%
Grey Wolf
9%

Current Energy

Vitality +14 points
Lunar Effect +8 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Beagle
Front Legs Rottweiler
Head German Shepard
Ears German Shepard
Snout French Bulldog
Mouth Maltese
Nose Husky
Eyes Grey Wolf
Color Maltese