Abigail Aragorn Crypto Dog - Mix of Poodle, Shiba Inu, Dachshund, Pug, Maltese, Yorkshire Terrier, Schnauzer, Grey Wolf, Labrador BK, St. Bernard and Husky

Achievements

None
Abigail Aragorn
Abigail Aragorn is the name, love is my game. And fetch of course... This dawg chases mice in a big data warehouse. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! It turns me on when I can show an older dog a new trick.
  • Purity 0%
  • Age 29 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGTAGGAGAAACCTTAATACCCGCATGAACA
G
A
C
G
T
A
G
G
A
G
A
A
A
C
C
T
T
A
A
T
A
C
C
C
G
C
A
T
G
A
A
C
A
Genes: IEA2KFCL6B4

Composition

Poodle
9%
Shiba Inu
9%
Dachshund
9%
Pug
9%
Maltese
9%
Yorkshire Terrier
9%
Schnauzer
9%
Grey Wolf
9%
Labrador BK
9%
St. Bernard
9%
Husky
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Dachshund
Front Legs Pug
Head Maltese
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Grey Wolf
Nose Labrador BK
Eyes St. Bernard
Color Husky

Parents

No Children