Hugh Huck Bitcoin Dog - Mix of Labrador BK, Dachshund, Grey Wolf, French Bulldog, Golder Retriever, Labrador, German Shepard, Border Collie, Beagle, Corgi and Rottweiler

Achievements

None
Hugh Huck
Here in cyberspace, I ain't got much use for a floppy disc. My favorite pastime is playing tug-of-war with my human's underwear. Size doesn't matter, I like 'em all. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) If we can run as a pack for a while, I'm open to that.
  • Purity 0%
  • Age 31 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAGGACCCCGAAGACCATCATACCTAAGCCAC
G
C
A
G
G
A
C
C
C
C
G
A
A
G
A
C
C
A
T
C
A
T
A
C
C
T
A
A
G
C
C
A
C
Genes: 6AL9857JDOH

Composition

Labrador BK
9%
Dachshund
9%
Grey Wolf
9%
French Bulldog
9%
Golder Retriever
9%
Labrador
9%
German Shepard
9%
Border Collie
9%
Beagle
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality +30 points
Lunar Effect -16 points

Traits Breakdown

Body Labrador BK
Tail Dachshund
Legs Grey Wolf
Front Legs French Bulldog
Head Golder Retriever
Ears Labrador
Snout German Shepard
Mouth Border Collie
Nose Beagle
Eyes Corgi
Color Rottweiler