Zeus Zane Litecoin Dog - Mix of St. Bernard, Grey Wolf, Husky, German Shepard, Border Collie, Maltese, Labrador BK, Dachshund and Pitbull terrier

Achievements

Racer
Zeus Zane
Hello, I be Zeus Zane. I am a web of clouds kind of dog. People food disagrees with me. Whew! You can tell. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm not into dog collars, unless you're into S & M.
  • Purity 3%
  • Age 31 days
  • Racing Exp 6
  • St. Bernard 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.27 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATCATGATACACCCCCGCAGGATGACCCTCC
A
C
A
T
C
A
T
G
A
T
A
C
A
C
C
C
C
C
G
C
A
G
G
A
T
G
A
C
C
C
T
C
C
Genes: 47BJKL6ABLN

Composition

St. Bernard
18%
Grey Wolf
18%
Husky
9%
German Shepard
9%
Border Collie
9%
Maltese
9%
Labrador BK
9%
Dachshund
9%
Pitbull terrier
9%

Current Energy

Vitality +15 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs St. Bernard
Front Legs Border Collie
Head Maltese
Ears Grey Wolf
Snout Labrador BK
Mouth Dachshund
Nose St. Bernard
Eyes Grey Wolf
Color Pitbull terrier