Zorro Zelda Digital Cryptocurrency Dog - Mix of Grey Wolf, Labrador, Schnauzer, French Bulldog, St. Bernard, Husky, Dachshund, Yorkshire Terrier, Beagle, Corgi and Rottweiler

Achievements

None
Zorro Zelda
As a digital dog, let me say Bob Dole did not invent the internet. Aggressive dogs that don't let 'me be me' frustrate me. Hound Dog by Elvis is probably the best song ever written. I love the smell of freshly cut grass. Spiked dog collars really turn me on.
  • Purity 0%
  • Age 29 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCCAATACGATGAACAGGATTACTAAGCCAC
C
C
C
C
C
A
A
T
A
C
G
A
T
G
A
A
C
A
G
G
A
T
T
A
C
T
A
A
G
C
C
A
C
Genes: L5C9B4AFDOH

Composition

Grey Wolf
9%
Labrador
9%
Schnauzer
9%
French Bulldog
9%
St. Bernard
9%
Husky
9%
Dachshund
9%
Yorkshire Terrier
9%
Beagle
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality +25 points
Lunar Effect +4 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Schnauzer
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Dachshund
Mouth Yorkshire Terrier
Nose Beagle
Eyes Corgi
Color Rottweiler

Parents

No Children