Zorro Zelda Digital Cryptocurrency Dog - Mix of Grey Wolf, Labrador, Schnauzer, French Bulldog, St. Bernard, Husky, Dachshund, Yorkshire Terrier, Beagle, Corgi and Rottweiler

Achievements

None
Zorro Zelda
As a digital dog, let me say Bob Dole did not invent the internet. Aggressive dogs that don't let 'me be me' frustrate me. Hound Dog by Elvis is probably the best song ever written. I love the smell of freshly cut grass. Spiked dog collars really turn me on.
  • Purity 0%
  • Age 15 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCAATACGATGAACAGGATTACTAAGCCAC
C
C
C
C
C
A
A
T
A
C
G
A
T
G
A
A
C
A
G
G
A
T
T
A
C
T
A
A
G
C
C
A
C
Genes: L5C9B4AFDOH

Composition

Grey Wolf
9%
Labrador
9%
Schnauzer
9%
French Bulldog
9%
St. Bernard
9%
Husky
9%
Dachshund
9%
Yorkshire Terrier
9%
Beagle
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -35 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Schnauzer
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Dachshund
Mouth Yorkshire Terrier
Nose Beagle
Eyes Corgi
Color Rottweiler

Parents

No Children