Fuzzball Frou-Frou Cryptocurrency Game Dog - Mix of Rottweiler, Husky, Pitbull terrier, Border Collie, Grey Wolf, Dachshund, Corgi, Labrador BK and Boxer

Achievements

None
Fuzzball Frou-Frou
I absolutely love long walks when I can stop and smell the bushes. I like nibbling on most everything, but I'll bite if you want me to. Shy dogs that tuck tail bore me. I'm willing to try little bondage, so my human chained me up!
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTCCTACCCCGGAAGCACAGCAAACACACAC
C
A
C
T
C
C
T
A
C
C
C
C
G
G
A
A
G
C
A
C
A
G
C
A
A
A
C
A
C
A
C
A
C
Genes: HNJLAO46G4H

Composition

Rottweiler
18%
Husky
18%
Pitbull terrier
9%
Border Collie
9%
Grey Wolf
9%
Dachshund
9%
Corgi
9%
Labrador BK
9%
Boxer
9%

Current Energy

Vitality +49 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Border Collie
Front Legs Grey Wolf
Head Dachshund
Ears Corgi
Snout Husky
Mouth Labrador BK
Nose Boxer
Eyes Husky
Color Rottweiler

Parents

No Children