Rookie Rayman Bitcoin Game Dog - Mix of Labrador BK, Shiba Inu, German Shepard, Husky, Pug, Pitbull terrier, Schnauzer, Boxer and Grey Wolf

Achievements

None
Rookie Rayman
Whatcha know, honey. Rookie Rayman here. After introductory sniffing, I like some licking. Blue toilet water turns me off. I never knew my father. Air Bud is definitely my favorite movie. What a role model!
  • Purity 3%
  • Age 32 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATCAGCAACAGTAGAATCCGTAATAAACCCC
G
C
A
T
C
A
G
C
A
A
C
A
G
T
A
G
A
A
T
C
C
G
T
A
A
T
A
A
A
C
C
C
C
Genes: 6764E2NECGL

Composition

Labrador BK
18%
Shiba Inu
18%
German Shepard
9%
Husky
9%
Pug
9%
Pitbull terrier
9%
Schnauzer
9%
Boxer
9%
Grey Wolf
9%

Current Energy

Vitality +49 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Labrador BK
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pitbull terrier
Mouth Shiba Inu
Nose Schnauzer
Eyes Boxer
Color Grey Wolf