Spud Sektor Crypto Dog - Mix of Labrador, French Bulldog, German Shepard, Yorkshire Terrier, Husky, Boxer, Beagle and St. Bernard

Achievements

None
Spud Sektor
My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I'm willing to try little bondage, so my human chained me up! I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 4%
  • Age 31 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAACAAACCCACTACGATCACGATGACCATCA
T
T
A
A
C
A
A
A
C
C
C
A
C
T
A
C
G
A
T
C
A
C
G
A
T
G
A
C
C
A
T
C
A
Genes: F4G5D979B57

Composition

Labrador
18%
French Bulldog
18%
German Shepard
18%
Yorkshire Terrier
9%
Husky
9%
Boxer
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality +10 points
Lunar Effect -2 points

Traits Breakdown

Body Yorkshire Terrier
Tail Husky
Legs Boxer
Front Legs Labrador
Head Beagle
Ears French Bulldog
Snout German Shepard
Mouth French Bulldog
Nose St. Bernard
Eyes Labrador
Color German Shepard

Parents

No Children