Faline Friday Cryptocurrency Dog - Mix of French Bulldog, Poodle, Labrador BK, Shiba Inu, Pitbull terrier, Corgi, Golder Retriever, Schnauzer and Border Collie

Achievements

None
Faline Friday
I'm Faline Friday and I'd like to show you a trick or two. The cloud's my neighborhood. Blue toilet water turns me off. I'm always up for a nice long walk around the neighborhood. I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAGTACGATCCAGCGACGACCGAAGAATATAC
G
C
A
G
T
A
C
G
A
T
C
C
A
G
C
G
A
C
G
A
C
C
G
A
A
G
A
A
T
A
T
A
C
Genes: 6E9NOII98CJ

Composition

French Bulldog
18%
Poodle
18%
Labrador BK
9%
Shiba Inu
9%
Pitbull terrier
9%
Corgi
9%
Golder Retriever
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality +16 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs French Bulldog
Front Legs Pitbull terrier
Head Corgi
Ears Poodle
Snout Poodle
Mouth French Bulldog
Nose Golder Retriever
Eyes Schnauzer
Color Border Collie

Parents

No Children