Fiona Fabio Litecoin Game Dog - Mix of Beagle, Yorkshire Terrier, Pitbull terrier, Shiba Inu, Grey Wolf, French Bulldog, Husky, Corgi and Maltese

Achievements

None
Fiona Fabio
Hello, there. Fiona Fabio here. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I'm always up for a nice long walk around the neighborhood. Aggressive dogs that don't let 'me be me' frustrate me. My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCGTACTACCCCGAACAAGCACCTTATTACTA
T
C
C
G
T
A
C
T
A
C
C
C
C
G
A
A
C
A
A
G
C
A
C
C
T
T
A
T
T
A
C
T
A
Genes: NEDL94OKFFD

Composition

Beagle
18%
Yorkshire Terrier
18%
Pitbull terrier
9%
Shiba Inu
9%
Grey Wolf
9%
French Bulldog
9%
Husky
9%
Corgi
9%
Maltese
9%

Current Energy

Vitality +14 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Shiba Inu
Legs Beagle
Front Legs Grey Wolf
Head French Bulldog
Ears Husky
Snout Corgi
Mouth Maltese
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Beagle

Parents

No Children