Bumper Bronx Bomber Digital Cryptocurrency Dog - Mix of Shiba Inu, Pug, Yorkshire Terrier, Golder Retriever, Maltese, Labrador BK, Husky, Labrador and Pitbull terrier

Achievements

None
Bumper Bronx Bomber
Salutations! My name's Bumper Bronx Bomber. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I enjoy staying active, and running circles around puppies and young children. I want a mate that knows how to give a proper belly rub!
  • Purity 3%
  • Age 29 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGAAGTATTAAGAACCGCAACAGAACCATCC
G
T
A
G
A
A
G
T
A
T
T
A
A
G
A
A
C
C
G
C
A
A
C
A
G
A
A
C
C
A
T
C
C
Genes: E2EF8K6425N

Composition

Shiba Inu
18%
Pug
18%
Yorkshire Terrier
9%
Golder Retriever
9%
Maltese
9%
Labrador BK
9%
Husky
9%
Labrador
9%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Pug
Legs Shiba Inu
Front Legs Yorkshire Terrier
Head Golder Retriever
Ears Maltese
Snout Labrador BK
Mouth Husky
Nose Pug
Eyes Labrador
Color Pitbull terrier

Parents

No Children